BioRender Icon

Chromosome (with telomeric DNA sequence)

Use This Icon – Free
No credit card required to sign up.

This icon is fully editable in BioRender

  • Add text, shapes, & other icons
  • Search 50,000+ scientifically accurate icons
  • Recolor and rearrange every icon, line, & label
  • Export or share for any use case
Scientist Avatars

Join 4M+ scientists already making publication-ready figures

Go from icons to finished figure – in minutes

  • Search from 50,000+ scientifically accurate, peer-reviewed icons
  • Customize with labels, shapes, and additional icons – everything is completely editable
  • Export or share your figures with collaborators
page dashboard

Not quite the right icon? Discover more.

Search 50,000+ icons across 30+ life-science fields.

search icon
arrow-right
Keywords
nucleic acid,deoxyribonucleic acid,DNA,gene,genetics,genome,genomics,helix,helices,double stranded DNA,double-stranded DNA,dsDNA,gnome,dna replication,replication,DNA replication fork,replication fork,genetic,genomic,telomere,DNA (2D, squiggle 3),DNA (2D, squiggle 2),DNA replication (2D, fork),TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG,AATCCCAATCCCAATCCC,3',5',Chromosome (with telomeres 1),dNA,chromosome,chromatin,chromatid,proj-ai-timelines-24q3,proj-ai-timelines-24q3-sprint2
View More

Try a synonym, or sign up to request an icon from the app.

Image types

Chromosome (with telomeric DNA sequence) icon JPEG

Chromosome (with telomeric DNA sequence) icon PNG

Chromosome (with telomeric DNA sequence) icon SVG

Chromosome (with telomeric DNA sequence) icon GIF

Biorender Icon FAQs

How are scientists using the Chromosome (with telomeric DNA sequence) icon in their work?

BioRender users often use the Chromosome (with telomeric DNA sequence) icon in posters, grant applications, educational materials, and graphical abstracts. It’s especially useful for projects involving Nucleic Acids.

Can I use this icon in a BioRender figure or scientific illustration?

Yes, the Chromosome (with telomeric DNA sequence) is fully integrated into BioRender’s drag-and-drop platform. You can easily add it to any scientific figure, workflow, or poster, whether you’re building from scratch or starting with a BioRender template.

Is the Chromosome (with telomeric DNA sequence) icon customizable in BioRender?

Most icons in BioRender, including the Chromosome (with telomeric DNA sequence) icon, are customizable. You can adjust icon size, colors, and positioning, and add custom labels to tailor the design to your specific research context.

Can I export figures that include the Chromosome (with telomeric DNA sequence) icon for publication or presentations?

Yes, figures containing the Chromosome (with telomeric DNA sequence) icon can be exported in multiple formats, including PNG, JPG, PDF, and SVG. High-resolution and vector exports are available on paid plans, making them ideal for journals, slide decks, and print materials.

How do I cite BioRender if I use this icon?

Unlock publication permissions with a paid plan, and include 'Created with BioRender.com' in your figure legend, or cite BioRender directly per your journal's guidelines.

Is the Chromosome (with telomeric DNA sequence) icon used in BioRender templates or poster layouts?

Many BioRender templates include icons like the Chromosome (with telomeric DNA sequence) icon — especially those focused on Nucleic Acids. You can search BioRender’s template library or add this icon manually to any canvas.

What is BioRender?

BioRender is a web‑based software that helps you create scientific figures in minutes. Use this Chromosome (with telomeric DNA sequence) icon along with our library of more than 30,000 life science icons.

Looking for science content?

Browse 50K+ icons and templates that are peer-reviewed, easy to use, and free.

Find yours now
x icon