Not quite the right icon? Discover more.
Search 50,000+ icons across 30+ life-science fields.
Keywords
nucleic acid,deoxyribonucleic acid,DNA,gene,genetics,genome,genomics,helix,helices,double stranded DNA,double-stranded DNA,dsDNA,gnome,dna replication,replication,DNA replication fork,replication fork,genetic,genomic,telomere,DNA (2D, squiggle 3),DNA (2D, squiggle 2),DNA replication (2D, fork),TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG,AATCCCAATCCCAATCCC,3',5',Chromosome (with telomeres 1),dNA,chromosome,chromatin,chromatid,proj-ai-timelines-24q3,proj-ai-timelines-24q3-sprint2
Try a synonym, or sign up to request an icon from the app.
Image types
Biorender Icon FAQs
Can I use this icon in a BioRender figure or scientific illustration?
What is BioRender?
.png)








