Make scientific figures in minutes

Create publication-quality figures with pre-made icons and templates, all from BioRender's web-based software

Thank you! Your submission has been received!
Oops! Something went wrong while submitting the form.
USE ICONS IN THE APP

Try a synonym, or sign up to request an icon from the app.

Telomere

Telomere - Editable icon of Telomere
[]
Keywords
DNA (2D, squiggle 3),DNA (2D, squiggle 2),DNA replication (2D, fork),TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG,AATCCCAATCCCAATCCC,3',5',Chromosome (with telomeres 1)

Join 1,500,000 other scientists on BioRender

Sign up for your free account and start creating scientific figures faster today
SIGN UP FREE
Decorative Chat Icon

FAQ

What is BioRender?
BioRender is a web-based software that helps you create scientific figures in minutes. Our program has a library of more than 30,000 life science icons, as well as drag-and-drop functionality to help you make professional figures quickly.
How can I use this icon?
You can use this icon and thousands more by signing up for a BioRender account at https://app.biorender.com
I want a variation of this icon. How do I know if it's available?
You can browse our library by typing in the search bar above or sign up for BioRender and search in the app. Can't find an icon? Premium users can request custom icons and we'll make them in as little as 48 hours.
Where can I use figures I make with this icon?
Figures made in BioRender can always be used for educational use. If you'd like to use a figure for a publication, you must be registered for a premium plan. You can find more details on our pricing page
I have other questions. How do I contact support?
You can contact us anytime at support@biorender.com. We aim to get back to all requests within 24 hours.

Looking for science content?

Browse 50K+ icons and templates that are peer-reviewed, easy to use, and free.

Find yours now