Make scientific figures in minutes
Create publication-quality figures with pre-made icons and templates, all from BioRender's web-based software
Use Icons In The App
Try a synonym, or sign up to request an icon from the app.
Telomere
Use this icon in BioRender along with 1000s of others to make your next science figure in minutes
SIGN UP FREEKeywords
DNA (2D, squiggle 3),DNA (2D, squiggle 2),DNA replication (2D, fork),TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG,AATCCCAATCCCAATCCC,3',5',Chromosome (with telomeres 1)
Image types
BioRender icons and templates meet journal, grant, and copyright standards. For AI-generated figures, policies vary. Learn More
Join 1,500,000 other scientists on BioRender
Sign up for your free account and start creating scientific figures faster today
FAQs
What is BioRender?
Can I use this icon in a BioRender figure or scientific illustration?
